2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
CAS: 848463-13-8
Ref. 3D-YIB46313
50mg | A consultar | ||
100mg | A consultar |
Información del producto
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.
Propiedades químicas
Consulta técnica sobre: 3D-YIB46313 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
Si desea solicitar un presupuesto o realizar un pedido, por favor añada los productos deseados a su carrito y solicite un presupuesto o pedido desde el carrito. Es más rápido, más barato, y podrá beneficiarse de los descuentos y las ventajas disponibles.