2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol

CAS : 168130-88-9

Ref. 3D-TGA13088

Informations sur le produit

• Nom: 2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol

Description

2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol is a chiral molecule that can be used as a medicine. It is an active compound that has been shown to have antitumor and antiviral activity. The nucleic acid sequences of this drug are also known as 2,2,3,3,3 -pentafluoro-1-(4′hydroxyphenyl)propane 1′ -one. The sequence of the drug's nucleic acid is ACGTAGGCCGGGCACCTCGTCATCGCGCTGGTGGCACTCCAACCGATATCGCCAGCAAGCTCAGTCAGACGTGCGGCGCTTGTCAACAACAAGAACCAGTCTAGTTGGTTTCCTTC. This drug binds to the DNA in cancer cells and prevents replication of DNA by inhibiting the

• Marque: Biosynth

Propriétés chimiques

• Masse moléculaire: 232.17 g/mol
• Formule: C₇H₅F₅OS
• Degré de pureté: Min. 95%