2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol
CAS : 168130-88-9
Ref. 3D-TGA13088
1g | Arrêté | ||
5g | Arrêté | ||
10g | Arrêté | ||
100mg | Arrêté | ||
250mg | Arrêté | ||
500mg | Arrêté |
Informations sur le produit
2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol is a chiral molecule that can be used as a medicine. It is an active compound that has been shown to have antitumor and antiviral activity. The nucleic acid sequences of this drug are also known as 2,2,3,3,3 -pentafluoro-1-(4′hydroxyphenyl)propane 1′ -one. The sequence of the drug's nucleic acid is ACGTAGGCCGGGCACCTCGTCATCGCGCTGGTGGCACTCCAACCGATATCGCCAGCAAGCTCAGTCAGACGTGCGGCGCTTGTCAACAACAAGAACCAGTCTAGTTGGTTTCCTTC. This drug binds to the DNA in cancer cells and prevents replication of DNA by inhibiting the