![2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid](https://static.cymitquimica.com/products/3D/img/YIB46313.png "Cliquez pour agrandir")
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
CAS : 848463-13-8
Ref. 3D-YIB46313
| 50mg | 1.020,00 € | ||
| 100mg | 1.334,00 € |
Informations sur le produit
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.
Propriétés chimiques
Question d’ordre technique sur : 3D-YIB46313 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
Si vous souhaitez demander un devis ou passer commande, veuillez plutôt ajouter les produits souhaités à votre panier, puis demander un devis ou passer commande à partir de votre panier. C'est une méthode plus rapide, plus économique, et vous pourrez bénéficier des remises disponibles ainsi que d'autres avantages
