2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
CAS: 848463-13-8
Rif. 3D-YIB46313
50mg | Prezzo su richiesta | ||
100mg | Prezzo su richiesta |
Informazioni sul prodotto
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.
Proprietà chimiche
Richiesta tecnica su: 3D-YIB46313 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
Se si desidera richiedere un preventivo o effettuare un ordine, si prega invece di aggiungere i prodotti desiderati al carrello e poi richiedere un preventivo o un ordine dal carrello. È più veloce, più economico, e potrà beneficiare degli sconti disponibili e di altri vantaggi.