2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid

CAS: 848463-13-8

Ref. 3D-YIB46313

Informação sobre produto

• Nome: 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid

Descrição

2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.

• Marca: Biosynth

Propriedades químicas

• Peso molecular: 324.3 g/mol
• Fórmula: C₁₈H₁₆N₂O₄
• Pureza: Min. 95%