![2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid](https://static.cymitquimica.com/products/3D/img/YIB46313.png "Clique para ampliar")
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
CAS: 848463-13-8
Ref. 3D-YIB46313
| 50mg | A consultar | ||
| 100mg | A consultar |
Informação sobre produto
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.
Propriedades químicas
Consulta técnica sobre: 3D-YIB46313 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
Se desejar solicitar um orçamento ou fazer uma encomenda, por favor, adicione os produtos ao seu carrinho e depois solicite um orçamento ou encomenda a partir do carrinho. É mais rápido, mais barato e poderá beneficiar-se dos descontos e outras vantagens disponíveis.
