2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol
CAS: 168130-88-9
Ref. 3D-TGA13088
1g | 863.00 € | ||
100mg | 219.00 € |
Product Information
2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol is a chiral molecule that can be used as a medicine. It is an active compound that has been shown to have antitumor and antiviral activity. The nucleic acid sequences of this drug are also known as 2,2,3,3,3 -pentafluoro-1-(4′hydroxyphenyl)propane 1′ -one. The sequence of the drug's nucleic acid is ACGTAGGCCGGGCACCTCGTCATCGCGCTGGTGGCACTCCAACCGATATCGCCAGCAAGCTCAGTCAGACGTGCGGCGCTTGTCAACAACAAGAACCAGTCTAGTTGGTTTCCTTC. This drug binds to the DNA in cancer cells and prevents replication of DNA by inhibiting the
Chemical properties
Technical inquiry about: 3D-TGA13088 2,2,3,3,3-Pentafluoro-1-thiophen-2-yl-propan-1-ol
If you want to request a quotation or place an order, please instead add the desired products to your cart and then request a quotation or order from the cart. It is faster, cheaper, and you will be able to benefit from the available discounts and other advantages.