2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
CAS: 848463-13-8
Ref. 3D-YIB46313
5mg | To inquire | |
10mg | To inquire | |
25mg | To inquire | |
50mg | To inquire | |
100mg | To inquire |
Product Information
2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid, also known as 2MMIBA, is a fluorescent probe that can be used to label DNA. 2MMIBA binds to the nucleotide sequence 5'-CAGTCAATCGCTTCTTAGGTTGCGGCCAGTGACATGGCACTGAGGCGGCTGTGCAGGCACGTGCAACAGCCTGCTTCAACCCTCCACC (SEQ ID NO: 1), which is found in the human alpha globin gene. The probe has been shown to bind specifically to alleles of this sequence in various populations and has been used for the study of population genetics.
Chemical properties
Technical inquiry about: 3D-YIB46313 2-Amino-5-[(1-methoxy-2-methylindolizin-3-yl)carbonyl]benzoic acid
If you want to request a quotation or place an order, please instead add the desired products to your cart and then request a quotation or order from the cart. It is faster, cheaper, and you will be able to benefit from the available discounts and other advantages.